CR70142

CRIMIC CR70142

Gene ctl2

CG11880

Information

Donor Location Cytology FBti Stock number
int200_PM37_kG4 3R:29123370..2912824798F10-98F12

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
long band OK TTCACCAGCCCATCCAAAGCCATT GGCTTCAGCGATCTGTTACATCCT

Images

Construct Design Sequences

sgRNA sequence CTTTCAGTAGAGAGCGATGACGG
sgRNA2 sequence TTGCTCAACCGGCTGCAATTGGG
 
left_200bp right_200bp
GTTGGCTTCACCGCCAACACGACCACCCACTACAGATTCGGTTTTCCATTTTTAAAACAATGACGCATGCACGGAAATAAATTACATGATATACGCCTGACAATCTCATTACCTAGAGACGACGACCCATCGATAGTGGCTCTATGTATATACATACATAAAACACTCGGTTCTTCTTGGACTCTTTCAGTAGAGAGCGA ATTGGGTTTGCATTAAATGCACGCTCCTTTGCCAATACTCTTAATCTTTAATCTAGTGTATATAATACGCCAGTATCCGTATCCATATGTAAAGTTTTTTGTGCGGCTAGACATGTGATAGGCGCGGACCATAAAGACCAAAAGTAATACCATACAATAACATGTATACAGAGACACAAAAGTACATATCTCACATTCAT
 

Search Again