CR70184

CRIMIC CR70184

Gene CG8202

CG8202

Information

Donor Location Cytology FBti Stock number
int200_PM37_kG4 3R:8732091..873583785A9

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK OK GCGTCGCTTGTCAACTGCATTT GGTGTTCTCATTCGTCAGCCATAG

Images

Construct Design Sequences

sgRNA sequence CAACAACAACCACGACGCTATGG
sgRNA2 sequence CAAAAACGTAGGAGAGAACCGGG
 
left_200bp right_200bp
TAAATCTTTAAATTAAATCTTTTTTATAAATTAATTTCTATAGAGCTGCAAGCGAAACGAAATATATACAGTAGAACAGGTTCTAAGCTAAAGTCCCTGGAATTAGTACAGTTTCTTTGGTGTATTTCACCCCTGACCGGCTACGTCCATGTCATGTTGGCAAGCAGCTGTCAGGAATGCCGACAACAACAACCACGACG TCTCTCCTACGTTTTTGCTTAACCTTGACGAGGAACCGACAAATTTTGTATTACATTTCTGTGCAATTAAAAGTTATAACGTTTGTGGATATAAATAAAAATTTTACCATACCTACGTAGGTGATAAACGCGTACTTAGTAGATGGTTTCATTAAACTAAAACAACATTTTTATGGTGTTTGTAAAAGCGCAATTTTTTA
 

Search Again