CR70193

CRIMIC CR70193

Gene Pex2

CG7081

Information

Donor Location Cytology FBti Stock number
2XgRNA_int200_PM37_kG4 3L:8339051..834027666C7

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK OK GTCTCAGCTGACCAACTGGTTT CAAAGTAATGGCGTTGCCACATCG

Images

Construct Design Sequences

sgRNA sequence TTTGTTTATATTCTTGCCTTTGG
sgRNA2 sequence GGTTCTGCGTGTCCTGAGTCGGG
 
left_200bp right_200bp
TTAGCAATAAATAAAAAATCAAACCGCATTGCTAGTATGGCTAGTTTAAATTTGGCGGGGTTTGTCGATATAGTTTACCAGCACTGTTTAAAAATGTCGATAATGACTAGTAAACTTTCTTTACAATTGCCATCTCTAATTGATAAGAAAGGGCAGAGTACATATAAATAAGAAATATATCAATGGTCAGCTAACCAAAG GTCGGGAATCCAAAGTGTCTGATAAATAGGAATATAGTGCATGTGATGGTTTTATATGTCTTTTATTAGTTTTAAGCGAAAAGTGGGCTGTAAGTAATAAACAAATCATTTTCATATTCCGCCAAATGTGTGTACTTTTAGTGTTAGCAAGCAGAGTAGTGTTGGTAGTCGTACAAAAACAGCTATTATTTACTTGCCCA
 

Search Again