CR70317

CRIMIC CR70317

Gene amx

CG12127

Information

Donor Location Cytology FBti Stock number
gRNA_int200_PM37_kG4X:9245915..92473368D2

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse

Images

Construct Design Sequences

sgRNA sequence AGATAGAGCGGGGAATACGCCGG
sgRNA2 sequence CGTTATTATGTACACTGTAATGG
 
left_200bp right_200bp
TTGTTACGATGAGGGGAGAGGTATACTTATCTGTTTAGCCAATTTAATTGAGCCAAAACATATCTATAAACTATTCGATTCGCTTTTTAAAGAAATTTCTCCTGAGCATTCGCGGTTGATATTTTCATGCCACGCGTATACGGTCACACTCTCCCACCCCACTCATTTTCTTAAAGGGAAAAACAATAACATTTCCGGCG CAGTGTACATAATAACGAATGCAAATATGCAACCATTAGGAATAGCAAGATCTTCTCAAAAACGTGTACATAATTAATTAGGAAATGTATTTTATTAATAATGCCAAAAGTTCTTTTTTGTATATTTTATCTAGCACAATTCTTTGATCGTATCAATAAATAAGTGAAAGAGAAAATATAACCATCTCTTTCTCGTTCCT
 

Search Again