CR70329

CRIMIC CR70329

Gene stai

CG31641

Information

Donor Location Cytology FBti Stock number
gRNA_int200_PM37_p12L:6100377..612465323E

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
no band long band TGAGGCATCATCTCTATGCCTTCC ATGCTCATGCGGACTTACAGATTGTG

Images

Construct Design Sequences

sgRNA sequence CAAATTATGCAGATGACCCTTGG
sgRNA2 sequence
 
left_200bp right_200bp
TCACAATGCATCATTATGGCGAACTTCATTAGAGAAATGAATAATCCGTCAAGTAATTAGATAAATTACAAACGCCGTTCAGAAGCGGCATTAATAGCATTTAAGGCTTTTGACCTTAATGTAACAGCTTCACAGATTCTTCCTTTGGGGCATAAATCAGTTTAAACAATATGGCACGACACAAAGACGCAGAGCCAAGG GTCATCTGCATAATTTGAGGCCGGTTAGGAAATTAATTTGGTTAAGTCACATTCAAATCTTGTCGAGAGAATGGCGACTAGCATCAGGATGATGCATTTTGAAGTGCATTGCATGGCAAGGGAATTTAGATGTGCATCTCATTAACAAAATGTCCTTGGGGCAACTGGATGCAAAATCAAGTTATGGCATAATAAGCATA
 

Search Again