CR70359

CRIMIC CR70359

Gene CG11975

CG11975

Information

Donor Location Cytology FBti Stock number
gRNA_int200_PM37_kG43R:8993253..899521285C1

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK OK GTGGTAGTGATGCTGGCAG CGGCAATGGTAATGAAAATGAGTAATGTC

Images

Construct Design Sequences

sgRNA sequence GATGCTGGAAGCCCGGGCTCTGG
sgRNA2 sequence TATACCTTGAGACATGATTGTGG
 
left_200bp right_200bp
TAGCAAGAAGTTCTTAAACCCAAAAATATCCCGATTTAGCGGATCGTCTTTCCTCATTGAAAGTTATCGATTCACCGCCCGGCCACTTTTCGACGATACTCAACACTGTGTCATTGTTTTTATACGAAAAAACACAATCATCCGCCGTCCGAGCAATTGTTTTCCTGCCTGCCCAGCAACTGTATTGAAAATCACCAGAG TTGTGGATATTTTATATTTTATTTGAAACATAAACCGATAATCCAACATGCTCATTTAATTTTACTTTAGCCTTCATTTTATGCATTGCTACGCCAATTGTAACTTTAAAAGCTGAAAAAGGTTTTTGTTTTATTTCCACACTGAGAAATTAAGATTTACTTATTAATTTTAAATGAACTTGAGCTTATCGTTTTTGTTG
 

Search Again