CR70380

CRIMIC CR70380

Gene CG11737_CG31259

CG11737_CG

Information

Donor Location Cytology FBti Stock number
gRNA_int200_SA_kG43R:0..085A2

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
long band OK CAGCTTGTACGTTCGTAGCTCA TCTAGAGTTGTCACAGCGGTGA

Images

Construct Design Sequences

sgRNA sequence TTGAGAGAGATAATCGAGCCTGG
sgRNA2 sequence ACAGTAGGTATGCGAAGTTATGG
 
left_200bp right_200bp
GTTTTTATTAAATTTTGGTAAATGGGTAACAACTATAGTTTCGTTACTACAATCTTACTAAGGTATGGTAGCTTCTTATCATTCACAGTGCGTGCTTATCAAAATCGAATGACAATGGTATCATATCTACTATAATTAACGTATTAAAGTGGCAAAGTTTTAATTTATAAATGTTTACCGAGTTTGAGAGAGATAATCGA CTTCGCATACCTACTGTACAGTAAAAAAAAAAAACAGAAACAATAAATGTGTAACACAACGATGCAGCAAAACTTTAAATTAAATGCGCGACGCAGAATGGCCATTAAGGACTTTTAAGTGAGGAGCCGCAGAGTGGGCCAACATCAATCACGGAGACAACAAGCCGCTGGCACCCTTAAAGCCCCCCTTAAAGCCCCCT
 

Search Again