CR70382

CRIMIC CR70382

Gene CG9416

CG9416

Information

Donor Location Cytology FBti Stock number
gRNA_int200_SA_kG42R:19367248..1937370256D2FBti0221009

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK OK CAGTTGATTGCCGACGCC GACAAATGTGCGATCATCATTTGAAATGG

Images

Construct Design Sequences

sgRNA sequence GCGGGTCACCTAGAAGTCAGTGG
sgRNA2 sequence
 
left_200bp right_200bp
GTGGCTGCCGCACAGAGAGTTTCCTCTGTTTGTTGTTGTGGCAAGTGATTAGTTCAATCGATAAGCCTTTCGAAGGGGTGAAGTACGCGAGCAGATTACTTTTGCGCATCCCATTTGGTTTTTTACTTGCCTCACTTTTAATCGCCGAGAAGTTGCCTTCGCGCTCTTCTTCTTGCCGCCGGCGCGGGTCACCTAGAAGT CAGTGGAAAATGGGTCGATGTTGCACTGTAATCCCAATGGCATTTTGCATTCAGTTGCGGAATACCGAGTAAATAAAAAACATTTCGCTTAATTGCCTCAGTAGCCAGTCGTTTTTCTAGACCCACCCCCCCACCAACCAACCCAGTGGTTCTATTCGTTTTTAGGCCACACTCGCCGTCAGTTTTTATTTTAGTGGACA
 

Search Again