CR70387

CRIMIC CR70387

Gene Spp

CG11840

Information

Donor Location Cytology FBti Stock number
gRNA_int200_PM37_kG42L:542786..54465321E2

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK OK CTGGTGAACAATTAGCTCGATAAGC CGCATTACTGTTTACACAAATTACTGC

Images

Construct Design Sequences

sgRNA sequence TGAAAATCGCCGGCTTGCGGGGG
sgRNA2 sequence GTGTTAGTCCATATGAGCTATGG
 
left_200bp right_200bp
CAAATCAGATTTATCAGTTTTGAATCTCAACCGTTTTGGTATATTTTTCGGGAGTTTGGTGGCGGTGCGACCCCACCACAGAGGGTGGTATATTTTTGGTATATTGCGGTGCGTCCGATAGGCCCAGACGATGACCAGCGGTACCGATAACACAGATTGTTGACGTGTGCTGCTGCGTGTCATTTCGCTTTTCACCCCCG CTCATATGGACTAACACCGCTACAAAAGACGATTCACTTACTGAGTTAGTTATGTACGTTCCTTGGCCAGGCACAACAATCTTATTTAGTTCGGTTAGGTTACAATTGTAGAAAATGTTCCCTCGACTTTTTTACCGCAATCAATTTAAATATGTATTTCAAATATTTCTGTGGCTCCGCACAGGAGGCTTATATGTTTA
 

Search Again