CR70403

CRIMIC CR70403

Gene zyd

CG2893

Information

Donor Location Cytology FBti Stock number
gRNA_int200_PM37_p1X:23022898..23035550

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK OK GTCAGCTTTGGCTCACAAAG CAAGAAGCTGTCACGCCC

Images

Construct Design Sequences

sgRNA sequence AAAACATGGCTTGATTGGCTTGG
sgRNA2 sequence
 
left_200bp right_200bp
CTCATTAGTCGGAAATATAATGTCAATTTGCTTTATTATAGAACAAACTATAGTTCTTATACTTTTTACGCAAGTTACTCATAGAATATATGGTATGATAAAATTCGATGAATACTATACTACGTAATAGGGGGGAACGAAAGGAAAACGCTACCCAATAAACTATATATACTGTCGAATCGGATCACTAGCAGCCAAGC CAATCAAGCCATGTTTTACATTTTTTATTTCTCGATTTTTGTCACGCCCATGTTGATCGATATGCGGAAAATCCTTTTTGACCATACCCATTCTATCGCATGCATATTACCAAACCATTTATATAACAAATTTGGAAAAAAATTAATGAAAGAAAAGTAATGCTACAAGGAGTCTGTAGTACATTTTGATTTTTTGTTTA
 

Search Again