CR70408

CRIMIC CR70408

Gene CG17715

CG17715

Information

Donor Location Cytology FBti Stock number
gRNA_int200_PM37_p12L:22844220..22854541

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK OK CGCATCGAGGATGTGTTAAATGTTTC GTGTCTTTTGACACCACAATTGATTG

Images

Construct Design Sequences

sgRNA sequence CGTATGGAGGACATATGAATTGG
sgRNA2 sequence
 
left_200bp right_200bp
ACATAGTTAATATTTGCTTCTATTAAAAAATTGTGGGAGGGAATAGTGCGTAATGTTCATAGAACCCTTCCATTTCCTAAGTTGTGAGTGGGTGTGAAGCCTTATGCATTTATCTACTTGGTAGGGGTGGGAAGGTAACAGTTCCTATAGGCTCAGTGTAGTTATTCGGAGGTGGGAATTTTTCGTATGGAGGACATATG AATTGGAAAATGGTTTTTTCTATTTCTAATGCTGTAAGACAATTAAAGGATATTGGACAAGCGAAAATTGTTTGTACGAAACGCAGCAAAACAATTTTGATATTTTTAACTGCATGCCACCCAAAGTAATACACAGATTTTAAATTCTGTGTGTGTGTTTTGTGAGAATTGGATTGGGAATGATATAGATAAAGTTTGGA
 

Search Again