CR70439

CRIMIC CR70439

Gene Gcn5

CG4107

Information

Donor Location Cytology FBti Stock number
gRNA_int200_PM37_kG43L :12521129..1252401469C4

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK long band CAGTTGTTTTGACTACGCCCC GATGAAGGGAGAGTGGGTGG

Images

Construct Design Sequences

sgRNA sequence ATCGCAATATCTGCCGATCTTGG
sgRNA2 sequence CAAATGATGCAGTGATTCCGAGG
 
left_200bp right_200bp
GGACAAACGTAAAATCGTTAATAGAATATATATATTCAACCATTATTTCACCACCGAGAGAAATTCATTTGCACAAAACGCCAGGTTGGCAGCACCATCACTGCGCACAGCAAGTGGGCAAACTCGTTGTATCGCTTGTGAAATTTAAGGAAAAGTACACTTTGTTCAAAACTAACGGAGAGAATCGCAATATCTGCCGA CCGAGGAGCCCTGCATAAGGCCGAACATTTAATCGAACTAAATTATTATATTAATTCTATTTATTTTTAGAATTCTCTCCAGCTAAAGAAAAACCCGTATAGTTAGTTTGTCGTTATAGATACTTAGGTTAAGCTCAGTGTGTCCGTCTTGTTCACAGACGCGTTGTGTCTTTGGGAAGAATAAATCAGATCTATCGCCT
 

Search Again