CR70440

CRIMIC CR70440

Gene Mef2

CG1429

Information

Donor Location Cytology FBti Stock number
gRNA_int200_PM37_p02R :9958858..991349646C4-46C7

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
no band OK CTGCTATGCATCCGAATATTGACC CGGAAACGGAAGTGCGTTC

Images

Construct Design Sequences

sgRNA sequence TTCTGGCTGAGGCTACGTCTTGG
sgRNA2 sequence
 
left_200bp right_200bp
ACTCAGTTATTTTTTAATATAGTTCTTTATAACTTTCACAAAACTATCAAAATTTAAAGGCAGGCGTTTAAAAGTAGTTTTGCCTCTTTAGCACGGATATAATTTTCCTTTGCCGTACCCATTTTTTAACTGCCAAGCGTGTGCCGTGTCATCGCAAGGTTTTCCCACCGACTTTTCGTTCCTTTCTGGCTGAGGCTACG TCTTGGCCAAGCCATAAACGCGTCATCGTCGAGCAGTGAAAAACAAAAACAAAAAAAAAAAACAGAACAAGGAACAGTAACAACTTGTTTATGGTGCTGCCCCTTTGGCCTTGACTCGGCCATAATCGATTCATTACCAACTAGGCAGCTAGGAAACGAGCAAGGGCCTGGGCCACTTTCCCACTTGGCCGGGCCACTTT
 

Search Again