CR70444

CRIMIC CR70444

Gene Pkg21D

CG3324

Information

Donor Location Cytology FBti Stock number
gRNA_int200_PM37_p02L:786153..79079821E2

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
no band OK CCAGCTCGAGCAGTTGATCC CGTTCTTCGACTCTCTTATCACAATCC

Images

Construct Design Sequences

sgRNA sequence GGTGGTTGGCTATTGGGGACTGG
sgRNA2 sequence
 
left_200bp right_200bp
TAGATAATATAGTTCCGACCGAGGCAGCACGCGCATCTCGAAAAAAACAGAATCAGAATCGGTTGGGAACCGAAGCCGACATAAAAAAGCGGCGAGCGAGAAAAAAGGAAATACGAGCTGGGCCCGCGAAGAGTGTTTTTGAAATGCTAATTTCTATGCAAATAATTTGGAAAACAAGCAAAAGGTGGTTGGCTATTGGG GACTGGAGCGGGGTGGTGGGTGGTAACACCTCGCCCTGACATTCGGCTTATCATGTTTACCCTCTGAGCTGGAAATGAAACCAAAACTGAAACTCCATGACTAGGTCCAATTGCTGGGGAGGCGCCACGGATTTGGATTTGCCTTTCGGCTACGGCTTTATCTATGCTATGTTTTTGGGTCACACCGCCTAGGGGAAAAT
 

Search Again