CR70463

CRIMIC CR70463

Gene CG3708

CG3708

Information

Donor Location Cytology FBti Stock number
gRNA_int200_PM37_kG4X:928798..9300981D2

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK OK CATGCACTGTTTCTGGAATTCGC GACTTTCACTCGGTCAACGAGG

Images

Construct Design Sequences

sgRNA sequence ATCCCAATCATTGTGCAATTCGG
sgRNA2 sequence ACAAAATTTACAAGTGAATGTGG
 
left_200bp right_200bp
CAAAAATGCGATTGCTTCTGGGCAAATCCAAGGAATCATCAGCCGAATTTTCGTTCCCAGTAGTAGGCCGGTTTCTGTGGAAATCAAGGAACAGCTTTGATCTAGCATAGTAGTTTCCAAGTGCCCAGTCGCAGAGCTGGAATATACTTGTAGATTTATATACATATATGTTGCCAAATTTCGAAGTTATTGCACCGAAT ATGTGGTAATGATTTCTTATTAAATTCTACAGTTCGGCCAAAGCCAGTTCATCACAAATAAGGTGAACCCCTTCCCCTCCTAGCGCTACTTAAAAATGCTGGTGTAGTACTCCTCCTCCAGGTCGTACAAGTCCATGGCCATTTCGTCCCTAAGTTTCATCAGCTTCTTGTCGCACTCGCTCTGTGTGTTCCTGAACAGC
 

Search Again