CR70466

CRIMIC CR70466

Gene CG10920

CG10920

Information

Donor Location Cytology FBti Stock number
gRNA_int200_PM37_kG4X:7852481..78542447C1

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK OK CAGCTGCCATTGCAAAGATTAATCC CTGTGTTTCTTCTGTAGTCCTCGTATC

Images

Construct Design Sequences

sgRNA sequence AAGAAAACGATTTGTTATAATGG
sgRNA2 sequence AATATGGGGTATATCAGTGGAGG
 
left_200bp right_200bp
TTCTTTAAATAATATTTTAAATCTAGCCAGCCTTGGATACAATGTCAATTGTCAAATTCTCTAAGGCAGAAGGTCGCCTATGAAAAATCAGTATATTCGAACTGAAACGGCATTCGGTTCGATCATCAGTTCTTTCAACTAAATTCGAGTTTTTTGCTTTTGGCGAATTGAAATTGATATATCAAGAAAACGATTTGTTA TGGAGGATGAAGAGTTCAGAAGTGGGAAAGAATCAATCGATGGCAAGCACGGAAAATAGAATGAGATATGGAGAAAACGTATTTGGAACAAACTACAAACGAAATGAAAAAAGGCAAGAGAATATTTCATGGAGCATACATTTTGGATCGTGAAGAAAATTAGGAGTTAGTTAAATTTACAAACAAGTCGGTGGAGTGAG
 

Search Again