CR70475

CRIMIC CR70475

Gene CG31997

CG31997

Information

Donor Location Cytology FBti Stock number
gRNA_int200_PM37_p14:154654..156060102A4

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK OK CTTAAAAATGAGTTTTCATTTTGCTGTACTGACC GTATTTCTTAACAATTTCAATTAATTTTCGGGCTG

Images

Construct Design Sequences

sgRNA sequence AAACGGCATGTTGTTAAATCGGG
sgRNA2 sequence
 
left_200bp right_200bp
TTATTTTAACAGCCTTCACAGTTTCTCTGTGTGCTGAACAAAAAATTACAAAGAGTGACGCAGGTGAAATACGAATTTTCAAACGTCTTATTCCTGCCGATGTTCTACGAGGTAAGTATGGCAATCATCAGATTTAGAAATTTTCCATTATTAAAAGTTACAAGTTCAATATAAGTATATCTAAAACGGCATGTTGTTAA ATCGGGTGACACGCGTATAGTTTTAAGTAACATAAAAGGTATGGGCTAGTGTAACGCAAAAAAAAAACAACAACTAAATATCCCTCTCCTTTCTCAAGGTATTAATTTTGGCCACAAAAGGTATCATTCAGCCTATGGTGAACATTTATCGAGTGTTTTTGCTTTTGATGTATACGTGATCTATTATATAGTTTCCACAG
 

Search Again