CR70476

CRIMIC CR70476

Gene CG32006

CG32006

Information

Donor Location Cytology FBti Stock number
gRNA_int200_SA_kG44:150764..153538102A4

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK? OK TTTGTGAGTTCAGCAATAAATAGGTG GATTGTAATGTAACATTCTGTTTTGCCG

Images

Construct Design Sequences

sgRNA sequence GCGGGCGGACATGACGAAATCGG
sgRNA2 sequence
 
left_200bp right_200bp
TGTGAAAGTTTATGTGATTCATATATCTAACTATATATTTTTAAAAATGTTCATTTTCCATTGTGTATAAAAATAAATATAATGCATTTTGTGCAAGAGTATAAAATTTGAATACCTTGCCTAACAAGTGTTGCCATATTTAGTTTTCAACTTGATTTGTTAAAAAATTTGATTGATTAAGCTAACCAGCCACACCGATT TCGTCATGTCCGCCCGCCCGCACGACGGATCTCCTGAACTACAGATACATACATATGTATATACAAATAAGAAATAAATTTATTGTGTAGTACTTTAAAATAATAATTGATTTAAATTAACGCTCTGAAGTCATAGAAATAGCCTTTTTGGGCTCTTGACTAATATATATATAATAACTGAATGAACTAAATTATTTTTG
 

Search Again