CR70479

CRIMIC CR70479

Gene Crk

CG1587

Information

Donor Location Cytology FBti Stock number
gRNA_int200_PM37_p24:210224..213165102A8

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK OK CAATTTTGTGTGTTTCAGTTTTGGGAAAC GTAAACGATTTGATCCTGTTGTTGAACTTTG

Images

Construct Design Sequences

sgRNA sequence TATGTGCGCCATGTATTGACGGG
sgRNA2 sequence
 
left_200bp right_200bp
TCTTTCCCATTCAACTAGCTGAGTAACGGGTTCTCTCTTGTTTTGTTTGATATTTAGATCCAATGGCAAGGGTCTATGGTCAATTTTGTATTTCTTTAATTTAGTATGGAATGTACCTTTAAGGACGATGATAAAATGTCAATGATGATCTCTCATAGCCATTGCAATTTAGTATGTTTTTAATATGTGCGCCATGTATT GACGGGGTAAATAAATTGAAGAATTTAACGACGTAAACAAAAATAATTACGAATTAAAGGAACTCAATTTCTACTGTATGTCTCGCCACGCGGCATTTATTAAAGAATTAGATGAATAAACGTCTCAAGAATATTCTTTTTGATTTTAAAAGTTCTTTATTAATATAAATGTATATACATTAGAATATTAAAAATAGGTT
 

Search Again