CR70483

CRIMIC CR70483

Gene Jyalpha

CG45760

Information

Donor Location Cytology FBti Stock number
gRNA_int200_PM37_p04:879..5039101F1

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK OK CAAACCCAGCACGAACCAC CTCGTATAACTGTAGCGTATTGTGGAAC

Images

Construct Design Sequences

sgRNA sequence GTTATTATTCTCTAGAGTAAGGG
sgRNA2 sequence
 
left_200bp right_200bp
ATGACAATCTCTATCTTGGCATTGCATTGACCGTTTTGGTAATAGTCACTGGATTATTTACTTATTTTCAGGTAAATAAATGAATATGTCAAATAAATATTTCTAAATATTACAATTATCCTTATTGAAGTTAAGTCTAAGTTTGATTTTGTTCCTTTTTTTGATATTCAGAGATCCGTTTCTGTTATTATTCTCTAGAG TAAGGGTATACTGGATTCGTCGATAATTTTTTTCTCATTTTATTTCCCAATATCTATCGATATCCCAGAAAAAATTATGAAATTTCGCATTTCCACTAGTTGAGTAACGGATATCTGACAGTCGGGGAACTCGACTGTTGTATTCTCTCTTGTTGTAATACAAAAATTCTTTAGTATACAAATAATTTTTAACATTATTG
 

Search Again