CR70490

CRIMIC CR70490

Gene CG15035

CG15035

Information

Donor Location Cytology FBti Stock number
gRNA_int200_PM37_kG4X:7401698..74031747B2

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
GTGAGATTCGATTGGAAAAGCAAAATAG GTTCGATAACTGGCATAGTTGTAGGC

Images

Construct Design Sequences

sgRNA sequence ATAAAGGAAAGCGCAGGCTATGG
sgRNA2 sequence CAGTGTCGTCTAGAATAGATCGG
 
left_200bp right_200bp
AACAATACACTTTATGTTAGGTGGAATTTTATTTTTAACAACTGATGGATGATAGATGGCGTTGATTTAGTCGAAATATATGTCAAATAGATGTGACACCCCTTCGATTTAGTTTTCGTCTGACATTCGTTTGAATAGCACACAATCGCGTAGATTTCGTATAACATATACACATAGTTTTGTATAAAGGAAAGCGCAGG GATCGGATATCCAAGGCTATATACAATCATTGAACAGCCACTTCGTAGCAAATTTTACTGACAAAAAAGAATTGTTCCAAAAAACTTTTCAATCACTTATCACTTAACACAATCACTTATAGTAGATATTCAATCATTTAAGACTCTTTTCTTTTCAACTCTGCCATCACAAACCAATTTGTTTTGTACCTCTTTTTGTT
 

Search Again