CR70506

CRIMIC CR70506

Gene Tip60

CG6121

Information

Donor Location Cytology FBti Stock number
gRNA_int200_GFP_PT X:4114800..41174874A6-4B1

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
multi OK CTTTGAAAAGGCGACGCGAC GGGCATGATACAGGCAATGGAC

Images

Construct Design Sequences

sgRNA sequence TAGGGCGGCCTGCAAGTTTGCGG
sgRNA2 sequence AAGATGAGGAGATTACCATTTGG
 
left_200bp right_200bp
GATTGGTCGATAGTTATTTACGTTTCGCTATCTGGCAATACTGCTGTTTTAGGAAAAAAAAAACGCGTAAAATATAAACAAATGAAAATTAACCACAAATATGAGTTCGACGACGATGTGGCCTCCATATGCGAGTCAACGGTGGGTTCCGCTACGCCTTGGCGTGTTTTGGGTGTTCATTCTAATGGTTTTAACCGCAA GGTAATCTCCTCATCTTCTCCGTATAAATAACTGAGTTTAAACAGCTTTGAATCCGTTTTTTTTTGTTTTTAGATTTCCGCTACCAATATTCTTCATCGGATGATCCTGGCTTCGTTGTAGCTTGTAGTTTTCATTTACAGTTTCCGTTTTTAATGTTATAAACTAGTTTATATCATACAATATTATATATACTTTTGAG
 

Search Again