CR70536

CRIMIC CR70536

Gene Baf

CG7380

Information

Donor Location Cytology FBti Stock number
2L:8029462..803056528D3

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
long band OK CACAAATGCAATACTTTAATGCACTAACATTATAAC GCCTTCTATAGTGTTGCTTATTGTTG

Images

Construct Design Sequences

sgRNA sequence
sgRNA2 sequence
 

Search Again