CR70539

CRIMIC CR70539

Gene Dbp45A

CG12759

Information

Donor Location Cytology FBti Stock number
gRNA_int200_PM37_kG42R:9087834..9089802

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK OK ATCTTACCTGTCTAGAGCGTGAC ACTGAATCCAGTGATGCGCC

Images

Construct Design Sequences

sgRNA sequence AACGTGCGCTGTATTAGTGATGG
sgRNA2 sequence GCTTGGTTGGGGTATCTTCTTGG
 
left_200bp right_200bp
ATTAATTATAAAATGTATTATTAATTTTATAGTGAATTTTTTCTTATTACTCGCCAATAATTCTGCGGTTGAAGTAAATAAAAAATTTAATTGAATTTAAATTAAAAATGCGTACTAAATACAGCTAACCACTCACACGGAGCAAAAATTAAAAACGTATCGATAGTTATATACCGATACAGAAGACAATACTTCCATCA AGATACCCCAACCAAGCCACTGAAAAGGCTTAACAAAGAAAAACCAGTTGCCCAAAAGGGCAGAGCAGATGTCAAGAAAGATAAAGCGTGATGTTTAAATATACTTTTATAAAATAACAAAATAACTTTTGAGCTTACACTGCTAAGTAGTTGCAAAATGCTTACTTAAATAATTTCAAAAATTCAGACATGCTAGAGCG
 

Search Again