CR70549

CRIMIC CR70549

Gene Ppm1

CG12169

Information

Donor Location Cytology FBti Stock number
gRNA_int200_PM37_p03L:581337..58281061C5

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK OK CGAACAAGATTTAATGTGCGCAATATGC ATGCGCACGCATACTACC

Images

Construct Design Sequences

sgRNA sequence TTCGGAATTCTGTTGGGTTATGG
sgRNA2 sequence TTTGTAGTGCCAACAGCGTCTGG
 
left_200bp right_200bp
CTTATTATTACGTGGGAAACGTTTGGCGGATATTAGTAATCCGAGTTGCATGGCAATCCTAATCGTTTCGATTAATCAAGTCGAAGTAGGCTACCGAGTCAGTCGTCTAAATTCAAAAACCCCATTTGGGCTATCAGAGACTGAATATACTATTTTTCTATAGTAGCTAAGAGGCGTGCGTACCTGTAAAAGGACCATAA GCTGTTGGCACTACAAAATTATCAGTCAACACATCACATTTCCCGGCAGTACAAATATAACACAATACACTACACTTTCCCCCAACTAGCAGGGAAATAAGAACACTTCGTTTTGTATTTTCTCGGGGATCAATGGATCGGATCTCTTGTTTAATTCGAGTTAATGTGCAAATCTATAGTACATTTTATAGCTACGTATA
 

Search Again