CR70564

CRIMIC CR70564

Gene zfh2

CG1449

Information

Donor Location Cytology FBti Stock number
gRNA_int200_GFP_PT 4:524125..524129102C4

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK OK GGATATTTGAACTTGTGACTGGATCTG CGGAGACTAAAAGTGGTGTGGAC

Images

Construct Design Sequences

sgRNA sequence AAACTAGTGCACCTGTTGGTAGG
sgRNA2 sequence
 
left_200bp right_200bp
ACATGCTTACAGGCTGTTCATTAAAACGCAAATGCCGATTGGGTTGATTATAAAAAGCCCTTCGGTTAGTTGCATCCCACTAATTGCTTCACACTTGAATAATCACGTTTGCTTCCAAATCCCAACCGGCATTGACAAGAAGCACCAATGAAAATATTCTTTGGTGAATTTGTAGAGAGGAGAGTGTTAAATGCCCTACC AACAGGTGCACTAGTTTTTTTCATTCTTACAATTTAATGTTGTTGGAAATTTGTATCACGCGGAACATTTAGGTTGCTTCTTTATTAAAAGGGTAAATATTAgATTTACAAATGCGAACAGAAAGCAAACAAGATTATAAGAATATACCATCATAAATTGTTGAATGGAGCAGAGTACATTGTATATTACGGATCTATTC
 

Search Again