CR70734

CRIMIC CR70734

Gene Rfx

CG6312

Information

Donor Location Cytology FBti Stock number
gRNA_int200_pM37_p13R:10361760..10378068 86B1-86B2

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK OK AGTGCAACCAGCTACAGCAACT TTCCGACGGTAACTGTTGGTGCTA

Images

Construct Design Sequences

sgRNA sequence AATCTGGACCACCTGTCGTCGGG
sgRNA2 sequence
 
Amplicon PCR 5' Left Amplicon PCR 5' Right Amplicon PCR 3' Left Amplicon PCR 3' Right
 
Amplicon 5' Amplicon 3'
 

Search Again