CR70742

CRIMIC CR70742

Gene p120ctn

CG17484

Information

Donor Location Cytology FBti Stock number
gRNA_int200_pM37_p22R:4595288..4609492

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK OK GGGAGTGGCTAGGTATTAAAGTGG CGTTTGTGAAATGAGTCAAAAAACCGC

Images

Construct Design Sequences

sgRNA sequence CGTAAAGGATTCCTTGTTCGGGG
sgRNA2 sequence
 
Amplicon PCR 5' Left Amplicon PCR 5' Right Amplicon PCR 3' Left Amplicon PCR 3' Right
 
Amplicon 5' Amplicon 3'
 

Search Again