CR70777

CRIMIC CR70777

Gene toe

CG10704

Information

Donor Location Cytology FBti Stock number
gRNA_int200_pM37_p13L:12422510..12432668 69C1-69C1

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK OK CGCTTTTGCAATTGACTGAGGC GAAATCGCAGAATTGCGGAATGG

Images

Construct Design Sequences

sgRNA sequence TAATTAAACCCCATGCAGATGGG
sgRNA2 sequence
 
Amplicon PCR 5' Left Amplicon PCR 5' Right Amplicon PCR 3' Left Amplicon PCR 3' Right
 
Amplicon 5' Amplicon 3'
 

Search Again