CR70840

CRIMIC CR70840

Gene Liprin-alpha

CG11199

Information

Donor Location Cytology FBti Stock number
gRNA_int200_pM37_p02L:6723903..6732766

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK OK CTGCAGCGACAGATTAACGC GACGGATGTGAATACAAAGAACTAATTC

Images

Construct Design Sequences

sgRNA sequence TTACTGAGACAATTGAGTAATGG
sgRNA2 sequence
 
Amplicon PCR 5' Left Amplicon PCR 5' Right Amplicon PCR 3' Left Amplicon PCR 3' Right
 
Amplicon 5' Amplicon 3'
 

Search Again