CR70858

CRIMIC CR70858

Gene Snx6

CG8282

Information

Donor Location Cytology FBti Stock number
gRNA_int200_pM37_Kozak 2L:8218071..828074128F3-28F3

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK OK GCGTCTTGTGTGGTTAAATACACG GCTGTAGAGAGGAATGCTTGTTTG

Images

Construct Design Sequences

sgRNA sequence TTTCAACTAGAGGTGGCATCAGG
sgRNA2 sequence TACTTCCGGCTCCCCGTCTCAGG
 
Amplicon PCR 5' Left Amplicon PCR 5' Right Amplicon PCR 3' Left Amplicon PCR 3' Right
 
Amplicon 5' Amplicon 3'
 

Search Again