CR70921

CRIMIC CR70921

Gene ND-B22

CG9306

Information

Donor Location Cytology FBti Stock number
gRNA_int200_pM37_Kozak2L:13370103..1337111034B8-34B8

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK OK GTTTGGTTATAGGTATCTACTCTAGACAGG TGTTACTGCTAGTTCATGAATCACGG

Images

Construct Design Sequences

sgRNA sequence TGTTGTTGTTGCCTCGGCTGCGG
sgRNA2 sequence GATTGGATGTGATTTGATTACGG
 
Amplicon PCR 5' Left Amplicon PCR 5' Right Amplicon PCR 3' Left Amplicon PCR 3' Right
 
Amplicon 5' Amplicon 3'
 

Search Again