CR70946

CRIMIC CR70946

Gene fd102C

CG11152

Information

Donor Location Cytology FBti Stock number
gRNA_int200_pM37_Kozak4:836986..844529

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK OK GCTGCCACACCAACAGTTTTG AACCGTGCTGAAAATGTAACCT

Images

Construct Design Sequences

sgRNA sequence CATTCACACTAAAACGACATTGG
sgRNA2 sequence AAAGTAAAAGATAATTTCATTGG
 
Amplicon PCR 5' Left Amplicon PCR 5' Right Amplicon PCR 3' Left Amplicon PCR 3' Right
 
Amplicon 5' Amplicon 3'
 

Search Again