CR70953

CRIMIC CR70953

Gene ClC-a

Information

Donor Location Cytology FBti Stock number
:11797244..1181320786F8-86F8

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK OK AGAGCATCGAGATCGATCCG ATTGAAGGGCAAGACTCAGGG

Images

Construct Design Sequences

sgRNA sequence
sgRNA2 sequence
 

Search Again