CR70958

CRIMIC CR70958

Gene CG8908

CG8908

Information

Donor Location Cytology FBti Stock number
gRNA_int200_PM37_p2:20264920..20270994 56F11-56F

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK OK GGCATATGTTTCGTATGAGTAATTTTCTAT CATGTACTCGAAGATCGCGGAC

Images

Construct Design Sequences

sgRNA sequence TCTGGGCAAATCGCGCATACTGG
sgRNA2 sequence
 
left_200bp right_200bp
 

Search Again