CR70962

CRIMIC CR70962

Gene Tango1

CG11098

Information

Donor Location Cytology FBti Stock number
gRNA_int200_PM37_p1:6649388..6654574

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK OK CTGCAGCGAAATAAGTTGATTTCAC CACCTCGTACAATAGATCCTTATCCC

Images

Construct Design Sequences

sgRNA sequence TTTAAGAGACATGGCTGTGCCGG
sgRNA2 sequence
 
left_200bp right_200bp
 

Search Again