CR70964

CRIMIC CR70964

Gene Gnpnat

Information

Donor Location Cytology FBti Stock number
:29738275..2974195299B9-99B9

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK OK GAACTGAACGTAAATGATAGCAAATGAGG CGAGAGCAGCTGCAGGAATC

Images

Construct Design Sequences

sgRNA sequence
sgRNA2 sequence
 

Search Again