CR70996

CRIMIC CR70996

Gene Idua

CG6201

Information

Donor Location Cytology FBti Stock number
gRNA_int200_kG4:11110557..1111306132D4-32D4

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK OK CTTGGGTTAAGCATGACTTTGTGTTC ACGCTTTTGCCGATTCCTTC

Images

Construct Design Sequences

sgRNA sequence CGAGCGAATCGCTCATCGCACGG
sgRNA2 sequence CTCACAAATAGTCGAATATCTGG
 
left_200bp right_200bp
 

Search Again