CR71002

CRIMIC CR71002

Gene PDZ-GEF

CG9491

Information

Donor Location Cytology FBti Stock number
gRNA_int200_kG4:6323767..6332789

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK OK GTCAAATTTCAGTTCTTTAGACGTACGG TTTAGTTGGGTCTGCTGAGAGGGT

Images

Construct Design Sequences

sgRNA sequence ACAGCAAAAGCTACCCCTCATGG
sgRNA2 sequence GATACGTTGTTTCTGATTGCTGG
 
left_200bp right_200bp
 

Search Again