Warning: Trying to access array offset on null in C:\wamp64\www\pscreen\crimic\info.php on line 28

Warning: Trying to access array offset on null in C:\wamp64\www\pscreen\crimic\info.php on line 29

Warning: Trying to access array offset on null in C:\wamp64\www\pscreen\crimic\info.php on line 30

Warning: Trying to access array offset on null in C:\wamp64\www\pscreen\crimic\info.php on line 31

Warning: Trying to access array offset on null in C:\wamp64\www\pscreen\crimic\info.php on line 32

Warning: Trying to access array offset on null in C:\wamp64\www\pscreen\crimic\info.php on line 33

Warning: Trying to access array offset on null in C:\wamp64\www\pscreen\crimic\info.php on line 34

Warning: Trying to access array offset on null in C:\wamp64\www\pscreen\crimic\info.php on line 35

Warning: Trying to access array offset on null in C:\wamp64\www\pscreen\crimic\info.php on line 36

Warning: Trying to access array offset on null in C:\wamp64\www\pscreen\crimic\info.php on line 37

Warning: Trying to access array offset on null in C:\wamp64\www\pscreen\crimic\info.php on line 38

Warning: Trying to access array offset on null in C:\wamp64\www\pscreen\crimic\info.php on line 39

Warning: Trying to access array offset on null in C:\wamp64\www\pscreen\crimic\info.php on line 40

Warning: Trying to access array offset on null in C:\wamp64\www\pscreen\crimic\info.php on line 41

Warning: Trying to access array offset on null in C:\wamp64\www\pscreen\crimic\info.php on line 44
CR71946

CRIMIC CR71946

Gene Act79B

CG7478

Information

Donor Location Cytology FBti Stock number
gRNA_int200_PM37_p1:..Order from Bellen Lab

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
CTTCCGAGGGAATGGGATCAAAAC CTTAGAAGCACTTGCGGTGGAC

Images

Construct Design Sequences

sgRNA sequence
sgRNA2 sequence
 
left_200bp right_200bp
 

Search Again