| sgRNA2 sequence |
| ( ! ) Deprecated: htmlspecialchars(): Passing null to parameter #1 ($string) of type string is deprecated in C:\wamp64\www\pscreen\crispr\phpMyEdit.class1.php on line 1168 |
| Call Stack |
| # | Time | Memory | Function | Location |
| 1 | 0.0001 | 374168 | {main}( ) | ...\construct.php:0 |
| 2 | 0.0001 | 389480 | phpMyEdit->__construct( $opts = ['hn' => 'localhost', 'un' => 'karen', 'pw' => 'flygirl', 'db' => 'crispr', 'tb' => 'construct', 'page_name' => 'construct.php', 'key' => 'ID', 'key_type' => 'int', 'sort_field' => [0 => 'gene'], 'inc' => 50, 'options' => 'ACPVF', 'multiple' => '4', 'navigation' => 'UDBG', 'display' => ['form' => TRUE, 'query' => TRUE, 'sort' => TRUE, 'tabs' => TRUE], 'js' => ['prefix' => 'PME_js_'], 'dhtml' => ['prefix' => 'PME_dhtml_'], 'cgi' => ['prefix' => [...]], 'language' => 'en-US,en;q=0.9', 'fdd' => ['CR' => [...], 'gene' => [...], 'FBgn' => [...], 'cg' => [...], 'vector' => [...], 'shipdate' => [...], 'plate' => [...], 'well' => [...], 'comment' => [...], 'sgRNA' => [...], 'sgRNA2' => [...], 'PCR5p_L' => [...], 'PCR5p_R' => [...], 'PCR3p_L' => [...], 'PCR3p_R' => [...], 'intL' => [...], 'intR' => [...], 'amp5' => [...], 'amp3' => [...], 'seqF' => [...], 'seqR' => [...], 'ID' => [...]]] ) | ...\construct.php:376 |
| 3 | 0.0008 | 410512 | phpMyEdit->execute( ) | ...\phpMyEdit.class1.php:3402 |
| 4 | 0.0077 | 456960 | phpMyEdit->display_record( ) | ...\phpMyEdit.class1.php:3202 |
| 5 | 0.0079 | 457824 | phpMyEdit->display_copy_change_delete_record( ) | ...\phpMyEdit.class1.php:2531 |
| 6 | 0.0086 | 478392 | phpMyEdit->display_change_field( $row = ['qf0' => 'CR72072', 'qf1' => 'l(2)dtl', 'qf2' => 'FBgn0013548', 'qf3' => '', 'qf4' => 'gRNA_int200_PM37_p1', 'qf5' => NULL, 'qf6' => '', 'qf7' => NULL, 'qf8' => '', 'qf9' => 'ACCACAGAGCATTGCCTAAGGGG', 'qf10' => NULL, 'qf11' => '', 'qf12' => '', 'qf13' => '', 'qf14' => '', 'qf15' => 'gtgcacaatgaacatttacaacaagttgcgggccagggagcatggctacggtgagtctttcgcttggcgggagaatctcacttttggcgctcgaatttcctgcgatcaaaggtgttgatttttaaaaggtttcaatgggttttcctggccatctggtcaatgtgcatcctgcacggccacctgaccacagagcattgcct', 'qf16' => 'aaggggtgaagaaacccgactagttgctccactggaaactgctgatcgtgcagaagttccgtggaaaacaaagccacggcactattttcatggtttctcctctggttttcgtttttctttttaggcaatgagaggacctacgacttcgccctgcgccgcctttccgtggccaaggaggacagctggcggggcatcgcgcc', 'qf17' => '', 'qf18' => '', 'qf19' => '', 'qf20' => '', 'qf21' => '6627'], $k = 10 ) | ...\phpMyEdit.class1.php:1102 |
| 7 | 0.0086 | 478440 | htmlspecialchars( $string = NULL ) | ...\phpMyEdit.class1.php:1168 |
|