CR80022

CRIMIC CR80022

Gene Sec61_alpha

CG9539

Information

Donor Location Cytology FBti Stock number
gRNA_int200_GFP-PT_p1:6477182..648057526D7-26D8

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK OK ACACGTCGACGTCGTCAATTC TGGTACAGCAGCAATTGGG

Images

Construct Design Sequences

sgRNA sequence
sgRNA2 sequence
 
left_200bp right_200bp
 

Search Again