CR92233

CRIMIC CR92233

Gene Mdr50

CG8523

Information

Donor Location Cytology FBti Stock number
PM37-p22R:14246966..1425259750E6Order from Bellen Lab

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
short and weak band OK TCCTTCGCGAGTCATTCAGGTCAA TCAAGATCTTGGCAGCAACCACAC

Images

Construct Design Sequences

sgRNA sequence AAGCGTGGTCATTGTGTTATTGG
sgRNA2 sequence
 

Search Again