CR92246

CRIMIC CR92246

Gene CG33947

CG33947

Information

Donor Location Cytology FBti Stock number
PM37-p13L:11096496..11098556Order from Bellen Lab

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
long band long band ACTGAATCAGCTGTTCCTCGCTGA TGTGATGGTCTACCGACTTGTTGC

Images

Construct Design Sequences

sgRNA sequence TTAGTCATTGTCCTTGGGATCGG
sgRNA2 sequence
 

Search Again