CR92249

CRIMIC CR92249

Gene lgs

CG2041

Information

Donor Location Cytology FBti Stock number
PM37-p14:436957..443911102B8-102C1 FBti0213505 91485

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK OK AGCAGAAGTTCTCCGAAGACCCTT GACTCGCTGGATGTACTGATACTG

Images

Construct Design Sequences

sgRNA sequence TTCCAAAAATCAGTAATCATTGG
sgRNA2 sequence
 

Search Again