CR92264

CRIMIC CR92264

Gene CG13699

CG13699

Information

Donor Location Cytology FBti Stock number
PM37-p23L:18154897..1816252275B13-75C1FBti0220971 Order from Bellen Lab

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
short band long band CCAACGCCAAGACATCAAGCCAAA CTTCATCCGAGTCTATACTCCTCC

Images

Construct Design Sequences

sgRNA sequence CAACTAAAGCCCCTGCAAAATGG
sgRNA2 sequence
 

Search Again