Insertion MI00103

Gene Information

Affected Gene(s)
Usp15-31          

PositionUsp15-31 - coding intron
PhaseUsp15-31-RA:0, Usp15-31-RB:0, Usp15-31-RC:0

Release 6 Annotation

Scaffold Coordinate Strand Site GBrowse Link
2R24744931+60D162R:24744931

FlyBase AnnotationTransposon
FBti0129191Mi{MIC}

Stock Availability

Donor/Collection Stockcenter Designation Stock No.
GDPBloomington 30618

Flanking Sequence

MI00103
(GS926437)
GATCGCCCAGCACCTGAGCTCAACGGTTAATGTCGTGGTAAGCGCGGAAA
AGTGTGGAAAGCTATATATATCAAAGAGCAAATGTTTCACAATGTATCTT
ACGATACATAATAGTACTATACATTCTATTACTATTACTCATCAAAACAT
ATCATGGTGCCCTTGGTCTCTTATTGTGAGTAATTGAACGGTTTTCTTAT
TTATGCGGCACAATAATTTATAAATCTAGGGTAACTAAGAAACAGTGGGC
TAATCACTGCAGTTTTTTCTATCTGGCTATTTACCTCTCTGGATGGTTAC
TTCCTTTAACTAAGGCATTACTTAGTTAATTACATTCAAATGAAAATATC
TAATACGAACTGTTTAGCTGCGATTAATGAGGGCGCATAAACGAAACTCA
TATATGCATGTAGTTCCCCCTAGTATACCTTTCCTTCTTCGCTTTGTTTG
CGCGCTGCTTAGAGCGCATCTTATAGTTTCTAAAAACCCCCCCTTCCCCA
CCCCCTCATTCCGCACTTAGTAGTGCCACAATGCCCCTTATCAGGAGTCC
AGCCGTACTTTCATAAAAGGCATCTTCGCTTAGTGCGTTATCGGCTGCTT
TGTTTTGCTCCCGCTGCTCTTTGTCTACGGCGGACGCATAGCATCTTCAT
CTGCATCTGGATGCGAGTGGCTCTGATTTGGCACCGTTCTGGTATTCTGG
TATTCTGGTGCTGGTTCTAGTTCTTTTGTGCCGCANAGAGTCGCCTCCCA
CCGGGTCAAG


Search Again