Insertion MI00694

Gene Information

Affected Gene(s)
CG5500     ro     

PositionCG5500 ro - coding intron
PhaseCG5500-RA:0, ro-RA:1, ro-RB:1

Release 6 Annotation

Scaffold Coordinate Strand Site GBrowse Link
3R26879873-97D53R:26879873

FlyBase AnnotationTransposon
FBti0131704Mi{MIC}

Stock Availability

Donor/Collection Stockcenter Designation Stock No.
GDPBloomington 33075

Flanking Sequence

MI00694
(HR505054)
GATCCTTTCTTTCTAATGAACTACAATCTTACCAACTGATATTTGACCTA
TAATAGCAATGATAACAACTAGCTTACAACATTACCTCTATGTTTCTGAG
CCGCTTTCTTCCCTTGGTGGTTTTATCTTTGGCTTTGGGAGTGTCAGTGC
CCGTCGTTGTGCTATTGGGCGGACAGCCACTTGCTGCCTCCTGGGCGGCC
GCATCCTTGCTGCTGGCATCATCCTGGGAGCTGCTGCCCGACAATTGGCG
GGCCAGTGAGGCCCAACGCTCGGCGCCACGTCGCAGAAGCAAGCATCGCG
GACAGCTGAAGCCCAGGGGAGCCAACATTTCCGCCCGATC


Search Again