Insertion MI01205

Gene Information

Affected Gene(s)
pyd          

Positionpyd - coding intron
Phasepyd-RJ:1

Release 6 Annotation

Scaffold Coordinate Strand Site GBrowse Link
3R8915908-85B43R:8915908

FlyBase AnnotationTransposon
FBti0142993Mi{MIC}

Stock Availability

Donor/Collection Stockcenter Designation Stock No.
GDPBloomington 35852

Flanking Sequence

MI01205-3'
(JM029555)
TATATAAATATCCATCCGCTCTGTGGAGCAGTGCTCCCTTTTTTTTTAAG
CTCCTCTATTTTTACATACAGCATGCACCATCCATTAAATGCATTTGTGC
ATATTTCGAAATCGTGGCACATTTACATTTTTTCGTTGATTTCTTGTGTG
GTTGTATTTTATTTTTTATTTCAGTTGTGTATTTCTGCATTTTGTGCTGT
CAGCTTTGTTCGATTTTTACTTTTCGCCATGAGTAGACAATATTTTTCCT
TGACTCTTTCCTGAATGGAAAATCCAAATGCAATTGCGAGCAACTTAGTT
TCAATTTTTTTTCTTTTTATTTTGTTTGGCAACCGTTCCGCTTTTATTCC
GGTTTTTTCTTTTTATTCCATCTGATGGCTTTTGAAGTCGAAGATTTTTG
GCTGTGAGTAGAGATC


Search Again