Insertion MI01307

Gene Information

Affected Gene(s)
p53          

Positionp53 - coding intron
Phasep53-RA:0, p53-RB:0, p53-RC:0, p53-RE:0

Release 6 Annotation

Scaffold Coordinate Strand Site GBrowse Link
3R23051175+94D103R:23051175

FlyBase AnnotationTransposon
FBti0141062Mi{MIC}

Stock Availability

Donor/Collection Stockcenter Designation Stock No.
GDPBloomington 35102

Flanking Sequence

MI01307
(HR865221)
GATCTGAATGTCCTGCAGCATCATTTCGCGCAGCACGGATTGCTGTAAGC
AAAAACAAGATATTATTTGAATGTCAACTTAACTCGCAATCATATAAGGG
TTCACACTTTGCGCTCATAGAGCTGATAGAGCTTCATGTTCCAGCTTGCT
CGAGTTACAAATGGACTGGCGATTTGTTTTGTATTCTATTCTATTTTTCA
CAAGTGCTTGAAATTCTCGCTAAACGATGACGACGGGAAGGAGTGCACCC
TGCTAATCGGCTAGATAAGAGTGTTTTGTTCTGTCCTCCAACTGAAAGTG
AACTTCGAAGCGACTTTGACGTCATGTCGCTCTTATGAAATTGCAGGCAG
CGGCTGAGTCACGCAAGGAATGCCGCTTCCCTCACGCTTCTTATGCTCTT
TTGTTTGTGGCTAGTAGTAGCACAACGCATGCTCAGTTGGTTTCTGGACG
GCCGGTGAAATACATGCGTTTCGCGATGTGTCCTGATAGTGTCCGGCTAC
TTGACAGGTCCTCTAGATGGCATCAGTGGGGTAGTTGGAAAACAATTAAG
CAGATATTAATGCTGTGGAAAGTGCGCTCACAGTTTGTATTAATTGTTCG
AGAGAAATGGACTTCACCAGCGACTACGCGCATCGGCGTATGGTGAAATT
TCTGACGATC


Search Again